I wrote a program

Earlier this year I shared that I had started doing Codeyear. After a few weeks, I realized I now knew enough to write a very basic program that translates DNA to protein. It took me a few days, and it’s super clunky, but it works!
Try entering “atggaatcatcggccggggag” to find a message. 🙂 (Hehe. Lame, I know.)
When you type in a string of A, C, G, and T it finds the first ATG to start from, and then translates codons until it hits a stop codon or the end of the sequence.
Nothing very groundbreaking (it doesn’t even understand upstream sequences!), but I’m excited that I got it to work! I learned C in undergrad, but never used it after the one course, and only ever did html/css for websites since then. So this is my first “useful” program.