I wrote a program

Earlier this year I shared that I had started doing Codeyear. After a few weeks, I realized I now knew enough to write a very basic program that translates DNA to protein. It took me a few days, and it’s super clunky, but it works!
Try entering “atggaatcatcggccggggag” to find a message. :) (Hehe. Lame, I know.)
When you type in a string of A, C, G, and T it finds the first ATG to start from, and then translates codons until it hits a stop codon or the end of the sequence.
Nothing very groundbreaking (it doesn’t even understand upstream sequences!), but I’m excited that I got it to work! I learned C in undergrad, but never used it after the one course, and only ever did html/css for websites since then. So this is my first “useful” program.

3 thoughts on “I wrote a program”

  1. Mike Fowler says:

    10 print “Awesome!”
    20 goto 10
    (no srsly, run! I suspect Eva will soon be inserting mind control programmes into her blogposts)

  2. Eva Amsen says:

    I already did. That’s why you’re commenting. Or did you think that was “free will”?

  3. Cath Ennis says:

    “Try entering “atggaatcatcggccggggag” to find a message.”
    I fell for that! Anyone else?

Leave a Reply

Your email address will not be published. Required fields are marked *

four × = twenty four

You may use these HTML tags and attributes: <a href="" title=""> <abbr title=""> <acronym title=""> <b> <blockquote cite=""> <cite> <code> <del datetime=""> <em> <i> <q cite=""> <s> <strike> <strong>