Category Archives: Expression Patterns

This is the archive of my posts that used to be at my Nature Network blog “Expression Patterns”

The Network Formerly Known As Nature Network

As of yesterday, most of the Nature Network blogs have moved to SciLogs, where Khalil Cassimally is their new community manager. I’ve known about this for a while, and having to move was the final motivation for me to get organized and put all my stuff (back) on easternblot.net. Bob didn’t move with the rest either, but I can’t find his new location, even though I know where he went. (Um, Bob? Where’s your blog?)
Redirects on the old blogs should point to the new ones. Mine isn’t working (yet), but I don’t know if that’s because I moved several weeks before everyone else or because I’m not on SciLogs, but if you’re reading this you clearly found me.

If you stopped reading Nature Network blogs because of technical issues (navigation, commenting, utter confusion) then this would be the time to visit SciLogs.com. Almost all the blogs are now there, and it’s much easier to find them. You can scroll through the bios in the sidebar and be amazed and surprised at all the people you forgot had a Nature Network blog. Look, it even got Jim and Anne-Marie to update their blogs again! Read their blogs – they’re great! Paige’s From The Lab Bench blog also moved. That was the only NN blog I recently managed to keep up with, because she’s been very active on Twitter as well.

All new blogs run on WordPress (as does this one, and the Node, PLoS PLOS blogs, all of Occam’s Typewriter, the entire Awl network and probably 99.999999% of other blogs), so congratulations, everyone, on NO MORE MT4!

A few years ago, when Nature Network blogs ran on their own proprietary platform and nothing worked the way we wanted to, we were looking forward to moving to Movable Type – the platform used by Scienceblogs at the time. Everything would be better once we had MT4! A lot of the jokes about it are now archived on easternblot. See them here or here. It became a beacon of hope. But when we moved in 2010, it quickly became apparent that things still didn’t work very well, and there were a lot of new problems. I don’t know what it looks like behind the scenes anymore, but from this side the move to SciLogs does look like it has solved most navigational problems already.

Now to update my feeds…

Bora’s Science Blogging Post

The title above should be read in the same way as you would read “McGraw-Hill Encyclopedia of Science and Technology” or “Merriam-Webster’s Dictionary of English Usage”. Bora’s post is a resource on a very specific topic, and future generations will refer to “the Bora” when they talk about the article.

The fact that Bora remembers that I was one of the first science bloggers makes me happy, because I was worried that my multiple virtual and physical moves over the past decade had made everyone lose track.

I started my first regular (non-science) blog in 2001, using Greymatter and then B2, but like many curious young university students those days I also experimented with Blogger and GeoCities. Just over a decade later I’m typing this on an iPad in the second-latest WordPress release, after a full day’s work managing my work WordPress blog. That’s right, procrastinating younger self, one day you’ll get paid to blog! (Not to play games, though, but don’t let that stop you.)

I digress. Must not let reading Bora’s blog affect my own post length!

My first actual science blog came out of my regular blog (which was called Easternblog). I had some science posts on there, but wanted to have a place where I could focus on only science. In 2005 I launched easternblot.net on another part of this very same domain where you are now. If you’re very quiet, you can still hear the pixels of the old posts. In 2007 I joined Nature Network, where I started another science blog, and then I started a music-and-science blog, and and and… Then I thought it was better to have everything in one place again (where you are now – unless you’re using RSS), but shortly after that I started a Tumblr again. I guess I need a constant number of blogs, and that number is bigger than 2.

What’s different now from ten years ago?

Bora gives a great overview of the major catalysts that drove the changes in the science blog community over the past few years. In summary, I think the are two BIG changes:

1. More people in general started blogging, so there are now a lot more science blogs. I no longer know everyone out there. Even Bora doesn’t know everyone out there anymore, and that’s saying something.

2. Commercialisation and institutionalisation of science blogs.

Neither change is bad, but they have both shaped the community enormously. What used to be an event with the goal to get together and put faces to screen names, has turned into an international conference on using the web for scienctific- and science communication. Am I talking about the North Carolina or the London version of Science Online? BOTH. That’s right, there are TWO events with the same history.

Effectively, we have now gone from a small globally dispersed community to such a large virtual network that it has become local again. Now, if you want to meet other science bloggers and tweeters, you don’t have to chat with friends across the globe, but you can drop by the pub in your area and meet several.

This is not unique to science bloggers, so I hope nobody is drawing the conclusion that scientists alone are suddenly more web savvy and keen to communicate. It’s a general trend.

When I had just moved to Toronto, I didn’t know many people. I did have a blog, and I knew there were regular blogger meetups. I was a bit nervous about it, so I first met up with just one local blogger, and only then took the plunge and went to my first GTA Bloggers meet up in October 2003. The people I met there are, to this date, some of my best friends.

I was lucky. Had I moved to Toronto a mere four or five years later, the local blog community would have been too big to really get to know people. In 2008, the same group of people who first met in groups small enough to go bowling were now at a massive, spectacular, Christmas party in a rented-out club. Twitter was the new medium of choice, and the hash tag of the event trended on Twitter. The event raised lots of money for the local food bank.

This is the same sort of growth – including the move to Twitter – we’ve seen in science blogging, which is now at a local level about the size that the entire blog community was in 2003. Now that I’m still relatively new in the UK, it has only been the online science community I’ve had a chance to meet. There are no general blogger meetups, because everyone has a blog or Twitter account these days.

I don’t think we quite know what to do with this massive pool of digital science enthusiasts, though. So far, the answer has been “launch more blog networks” and “get a hash tag for our scientific conference”, or occasionally “start a new business”. I don’t think any of those are necessarily things that strengthen the community. (Edited to clarify: I don’t mean to suggest they’re bad. They’re just not required for a strong community. That can happen independently of these efforts.)

I think there is a lot of potential, though, and I think that the answers lie offline rather than online. At last year’s Science Online London meeting I hosted a breakout session about the overlap between online and offline, and there were a lot of people in that room who had experience with very successful projects that were either started online and then taken offline, or vice versa. One of the best examples is Science is Vital, which would not have had the initial momentum required for its result (preventing a cut in UK funding), had it not been for a very engaged online community.

We may be bigger now, and less close-knit, but I think great things are still to come!

Don’t tell me not to learn!

I mentioned at the start of the year that I was doing CodeYear. You may be wondering how that is going. Still going strong! After about 5 weeks I cobbled together a little DNA-translator; a few weeks later I finished the entire JavaScript section.
We’re now in html/css lessons, but I already know most of that, so I’m not learning much right now. (I did learn one important new thing, though. I found out why so many websites look the same these days. Twitter Bootstrap! Aha! Oh Twitter, how far your influence stretches…)
So, it’s still fun, and I’m still learning things.
I actually tried to teach myself some coding (Python) a few years ago, but had to admit defeat – something I don’t easily do. I bought books and everything. I thought I’d be okay because I did take some classes at university. But even with the beginner books I was stuck. Why? I didn’t know what to use to actually type the code in, compile, run – all that stuff. I could write code in a text editor…and then…what? I had nothing to work in.
CodeYear is web-based, so you type in the browser, and now I can finally play around with things. When I made the DNA translator, however, I still had to google a bit to find out how to actually put javascript code into an html file so that I could display it on my own site. (I’m guessing they will teach this at some point, but we hadn’t covered it yet in week 5.)
I mention this to emphasize the difference between Learning to Code for Fun (which I’m doing) and Learning to Code for Serious (which involves knowing exactly what platforms to run your code on before you even start to learn the language, and not typing in browsers).
It’s rather like the difference between learning science from watching a lot of science documentaries and visiting the science museum, versus learning science in actual labs at actual universities. If you want to work in science, you do the latter. If you’re just interested and want to know more, you do the former.
If there were no documentaries and science museums, someone interested in science (but not professionally) would have to get their hands on university textbooks or journal papers and just jump in the deep end. That’s how I felt when I tried to learn to code a few years ago and didn’t even know what program to write the code in.
So as a geek-of-all-trades who likes learning more about everything, I’m happy that there is a site that lets me play around and learn things, just like I can learn more about geology by visiting a museum or watching documentaries or looking at rock formations while on vacation. And if I don’t want to code or don’t want to learn about geology, I don’t have to do those things. Nobody is forcing me. Nobody is forced to learn anything about science after the age of about 15, and yet there are lots of people visiting science museums and watching science programming to learn more about cell biology or physics or geology.
Wouldn’t it be weird if geologists got upset that random people wanted to learn more about geology? If they wanted geologists to be the only people to study rocks? That is apparently how some programmers feel about coding outreach projects. I read this blog post yesterday, and even commented, but it’s still bothering me. Today I realized why:
I should be allowed to learn ANYTHING I WANT.
EVERYONE should be allowed to learn ANYTHING THEY WANT.
I love when people do science experiments on their own, and I have never met a scientist who was opposed to the concept of amateur scientists. We don’t always take them seriously, but surely anyone can do science if they want to! What is this ridiculous elitist attitude of stating that non-programmers shouldn’t code?
You’re only making me want LEARN HARDER.

SciBarCamb intro game

SciBarCamb is over, but it was awesome this year! I am the worst at live-tweeting, but luckily Lou and Laura and lots of other enthusiastic Twitter-users were at hand to document every single minute of it, so keep an eye on the Schemes and Memes blog for Storify collections of the whole event.
I’ll just leave it to two things here. First, a massive thank-you to everyone who helped out in some way. The organisers, volunteers, sponsors, donors, the staff at our two venues, but most of all the participants – everyone who suggested or led a session, brought a demo, did stand-up, asked questions, and talked to others in the hallways in between the talks. That’s what SciBarCamb is all about!
And that brings me to the second point. One of the challenges of unconferences is to get everyone comfortable enough to talk to each other and work together to create a schedule. Last year at SciBarCamb, we had interactive name badges, that created an animated image when combined in the correct way, and among 100 participants every person had five possible matches. That was a lot of fun, but we didn’t want to do the exact same thing again.
This year, we started out thinking about matching keywords or phrases. For example, Watson and Crick. But you can also match both of them with DNA, and you could pair DNA with RNA, so it got rather complicated. In the end, we went with 12 sets of triplets. Each participant had one word on the back of their nametag, and on opening night they had to find two others form the same set. The first three complete sets won free drinks, and the very first team also got a T-shirt. (Three T-shirts, of course.)
sbc_tags.jpg
Backs of nametags
These are the sets of threes we used.
macromolecules containing biological information: RNA / DNA / Protein
inner layers of terrestrial planets: Core / Mantle / Crust
parts of an atom: Electron / Proton / Neutron
geologic periods of the mesozoic era: Cretaceous / Jurassic / Triassic
Boolean operators or logic gates: NOT / OR / AND
current or recent hadron colliders: **CERN: LHC / Fermilab: Tevatron
/ Brookhaven: RHIC**
flavours of neutrinos: electron neutrino / muon neutrino / tau neutrino
bones of the inner ear: stirrup / anvil / hammer
shapes of galaxies: lenticular galaxy / elliptical galaxy / spiral galaxy
trigonometric functions: sine / tangent / cosine
kingdoms of multicellular life: plants / animals / fungi
states of matter: gas / liquid / solid
There were doubles running around, but some people didn’t show up, so not all sets were complete. People who arrived late were scolded for not being there when there were free drinks at stake, so this had the added side effect of promoting early arrival – at least after the fact…

The second team to complete (via)
Because of people arriving late, the third team to complete was not actually complete, but I awarded them their drink for creativity. They were all neutrinos, but one person had manually changed “muon neutrino” to “electron neutrino” on their badge. The argument: this can happen in real life! There was no electron neutrino walking around the bar and they did know what the missing neutrino was, so they got their drink.
SBC_drinks.jpg
Me, two multicellular kingdoms and a geologic period of the mesozoic era with their free drinks. (via)
It seemed to have worked well as an icebreaking activity, giving people an excuse to talk to each other and look at each others name tags.
Feel free to use our sets at your own science event, or adapt/expand them.

Hoping they’ll lose Pinterest

The people who introduced me to blogging were not scientists or academics. They were online friends I’d met through playing games. A few of them set up their first blogs in 2001, and I thought it looked fun, so I started one as well. It was on an archaic blogging platform that doesn’t exist anymore. B2? Greymatter? Whichever came first. It was more a diary than anything else, and the only people reading it were my friends.

When I first started thinking about expanding my blog to cover science, there weren’t many other science blogs. I’d been clicking around to see what was out there, and I remember seeing the blog that was later revealed to have been the science blog of the woman who moonlighted as a prostitute and who blogged about that elsewhere under the Belle du Jour pseudonym. There were really only about five science blogs back then. It was ages ago. The web was young.

Now I manage a professional science blog, where researchers sign up for a WordPress account and blog about their work. Scientists have taken up blogging as an almost natural thing, and I don’t mind that at all. Of course they would. It’s a medium. You can use it for anything you want. Pictures of cats. Science. It makes sense.

The people who introduced me to Twitter were not scientists. They were my techie friends in Toronto, who I knew via blogger meetups. “What is Twitter?” I asked in a pub one night, and my friend said “It’s like Facebook, if it only had status updates.”

Now I manage two Twitter accounts for work. They’re followed by Twitter accounts from other scientific publishers. I don’t mind that at all. It’s a good way of keeping in touch. Twitter has become its own medium. You can tweet about anything you want. Sandwiches. Science. It makes sense.
I joined Facebook so I could see a friend’s photos that she uploaded there. She’s not a scientist.
Now I manage a Facebook page for work. I link to the posts and job ads that scientists have posted on our blog. Scientific societies ‘like’ my status updates – or at least the people managing their page do. I don’t mind that at all. Almost everyone has a Facebook page now, and subscribing to professional updates is a convenient way for them to see all the news they need to know in one place. Family news. Science news. It makes sense.

But sometimes, certain internet-minded scientists, who so fervently jumped on blogging half a decade after it first started, go a teensy bit overboard in their praising of an online tool.
I heard about FriendFeed via science bloggers. None of my other friends ever used it.
I heard about Google Wave at a science blogging conference. None of my other friends ever used it or even heard of it.

I heard about Google Plus via science bloggers. A few of my other friends created a profile, but immediately abandoned it – like everyone else.

The people who introduced me to Pinterest were not scientists, admittedly, but this time it only took weeks, not years, for the first science/web-people to jump on the bandwagon. They were really excited about it. Probably the most excited I have ever seen a group of mostly men be about a website of mostly pictures of dresses. And the dreaded questions were asked: “How can we use this for science?”

You can’t, okay! Just leave it!

Not EVERYTHING on the internet has to be twisted and molded into some sort of vehicle for science communication. If it’s a good fit for such communication, like blogging or Twitter, it will happen. But if you try to force your professional research interests onto something that is so purposely modeled after scrapbooks and inspirational pinboards and NOT after anything remotely resembling the way you normally distribute or find scientific information, you are only going to be annoyed and disappointed. Disappointed with the way it functions. Disappointed with the restrictions it imposes.

Why do I care? I didn’t care that FriendFeed or Google Wave or Google+ never worked out, but as soon as I now see the same group of people that thought those tools were the next big thing get completely disproportionately excited about an online product, I fear that it will succumb to the same fate. And I do rather like scrapbooks and inspirational pinboards.

Academics may have invented the web, but not everything that’s on the web has to do with academics. Nobody is going to judge you if you just want to use a product for fun, so please stop trying to turn everything you like into work.

My only consolation is Instagram – a safe haven of food and pets. Until the first person sepia-filters their lab notes and considers it as a medium for research dissemination, that is.

pinterest.png

Massive brain dump – unanswered questions

1.) SciBarCamb is in two weeks. If you’d like to spend a day-and-a-half meeting interesting people and talking about science in Cambridge for only £10 – sign up .
Ideas for sessions go here
YouTube videos of demos people are bringing along are here
2.) Nature Precedings is closing. I have a manuscript in there, and the archive will stay, so it doesn’t really affect me directly, but it raises many questions that are taking up space in my head that I need for other things, so I thought I’d leave them here as questions, and will think about them later. (Or if you have thoughts, leave a comment – I can’t promise I’ll respond immediately, but I’ll read it.)
To what extent was the NPG brand contributing to people uploading their material? And the fact that it’s indexed in Google scholar? Are FigShare and F1000 Research – the two alternatives for the things that ArXiV doesn’t take – (going to be) indexed in GScholar? Why is Precedings stopping, and what does that mean for the potential for success for those other ventures? Is the fact that preprints can’t be indexed in PubMed (a first stop for searching for most) a limiting factor? Is PubMed’s indexing requirement for journals-with-regularly-published-issues hindering initiatives aimed at storing smaller units of scientific data and preprints?
2b) Following up on that last question, how are people who are used to PubMed as the source of all they need to know going to find info stored in things like FigShare? And other storage places? Should there be a central search place for all those things? How would it work? Would it be curated by researchers, by publishers, by a library or by a company? (People would most trust a library, but companies and some publishers have more money and freedom to set it up.)
3.) Apart from the search questions above – are people going to upload data without the context of a paper at all? Do they need incentives? If uploading data without a paper around it becomes something that counts toward a better chance at funding, would that not eventually lead to mass production of data without particular research questions? Would it make room for people to do research entirely by analyzing data they didn’t produce? A sort of lab-less scientists, a boom of theoretical scientists in all fields? And if, in the future, these lab-less scientists publish insights based on data collected by others, will the people who uploaded data get double the credit? (For uploading, and later for having it used in an academic paper?) And how will funding work if the people who publish the most insightful work never spend any money on experiments, and the people who need the money to sustain the experiments only upload data and never think about it academically? Will science branch out into a non-academic producing form and an academic form?
That’s it. Hope that means I can stop thinking about all this while I’m supposed to be doing other things.

Not even a little bit qualified

I was as surprised as you are to find out that I am an expert on hematopoiesis and stem cells, but for the past several months I’ve been invited to several conferences asking me to speak on this topic, as well as other topics that I can’t even remember. All invitations came from BIT Life Sciences, who run a series of conferences in China on every imaginable topic in the life sciences.
Unlike most conferences, the conference organisers for BIT meetings are not themselves researchers in those particular fields. If they were, they would know that I never worked with stem cells. They would also not invite Derek Lowe (a chemist), or Michael Rosen (a children’s book author) to speak at events outside of their expertise. Jonathan Eisen has also written about getting these invitations to meetings outside of his field, and these are just the people who bothered to blog about it.
I’ve replied a few times, to say that I’m not the person they’re looking for. I think I even know where they got my address. It’s my work email address, which is listed on interviews I do with scientists who sometimes are world experts in fields like hematopoiesis. The interviews are indexed in PubMed and other databases.
Obviously BIT are scraping articles with certain keywords for email addresses. But that doesn’t explain how they found a children’s book author. In that case, I think they had a name, and tried to find a matching email address. It took me less a minute to find the academic email addresses for the two (!) Michael Rosens who actually are prominent biology professors, so that shows you how much effort and expertise went into that.
Tangentially related to this story, I did some Mechanical Turk tasks a while ago. I mostly did transcription tasks, because, even though the pay is just pennies, those assignments were often really interesting interviews or documentaries or lectures that taught me things about nuclear power in Canada and about urban planning in San Francisco as viewed by immigrant communities. On one occasion, though, I accepted a “find email addresses” task. It involved getting a list of names of scientists, and finding their email addresses. I did a Google search for all the names at once, to see what they had in common, and found that they had all been speakers at a a physics conference earlier that year. Conferences (legit, proper conferences) may pass on email addresses of registrants to sponsors of the meeting for a one-time mailing, but usually the email addresses are not public to people outside of the conference. This third party was now using Mechanical Turk to recruit people to find speaker contact info.
Nothing about the MTurk email address searching was illegal. You, too, are free to use Google to try to find someone’s email address. It was just a lot of manual work to search for each speaker individually to find their contact info, so they used distributed labour. What they then did with that info, I don’t know. For whatever reason, they wanted to email a bunch of physicists. Maybe they were selling some kind of thing of interest to physicists. (Blackboards, presumably, if my visit to the Perimeter Institute is any indication of what physicists like.) Maybe they were thinking of sending postdoc applications to every speaker at the meeting and couldn’t be bothered to look for the addresses themselves. Maybe, like BIT, they were also organising a conference.
But here’s the thing: Conference organisers that need to scrape papers en masse, or search online for email addresses, are not organising any kind of conference you want to attend. Proper conferences are organised by people in that field. People who would never email a children’s book author instead of a biology professor. Even if there is an event-organising specialist involved, who manages the practicalities and logistics of venue hire and meals, there are always scientists who select the speakers. And they know who they’re inviting.
The problem is not the annoying emails. You can ignore and delete those. The real issue is that some people do take up the invitation, only to find that the conference may not the kind of meeting they thought it would be. By then, they might have bought plane tickets or even paid registration fees.
One recipient of BIT’s unwanted emails has responded in a way that nicely exposes the lack of scientific rigour that goes into the selection of the talks. Using the name “Knut Buttnase”, one researcher accepted an invitation to speak at BIT’s Symposium for Bacteriology and Infection, using the “Center for Extraterrestial Sciences” as affiliation, and documenting the entire process on a blog.
“Buttnase” was then invited to chair a session, and to submit an abstract. The abstract they submitted is titled Effective Eradication of the Bit Bug by Massive Response with Mocked-Up Targets and it only gets better after that. I was relieved to see, when I looked up the original programme, that the co-chair spotted the ruse and seems to have withdrawn.
Despite Buttnase’s pioneering research in eradication of the “Bit Bug”, the bug is still rampant in inboxes of scientists, former scientists, and people who just happen to share the same name as a scientist. Rather than the suggested response with mocked-up targets, I propose mass immunisation: let as many people as possible know to ignore the emails. If nobody ever signs up, they will go away.

Would I eat that?

It’s something I rarely talk about, but this year is my 10th anniversary of being vegetarian. I don’t know exactly when, because it was a very gradual process. I started slowly phasing out meat from my diet in the late nineties, but lapsed in early 2001, when I was staying in Quebec for four months. Soon after I got back to Holland, though, foot-and-mouth disease hit Europe.
During the 2001 foot-and-mouth disease epidemic, hundreds of thousands of cows were killed in Holland alone. The news showed images of piles of dead cows lying on barricaded farms. Many of them were healthy cows, who were just killed to stop the spread of the disease.
I wasn’t the only one to give up meat entirely that year. After foot-and-mouth disease, followed by an outbreak of swine fever that same year, the sale of meat replacements in Holland increased dramatically. That was probably the only positive economic effect. A large number of farming families lost their business after being forced to have their animals killed, and across Europe the epidemic cost billions.
I stopped eating meat because seeing piles of dead cows on the news made me realize how they are not treated like animals, but like objects. I do still eat fish once in a while, because they don’t have the same “aww” factor and because they are swimming freely until they’re caught, and not squished in the tiniest possible spaces. Other vegetarians have other reasons for not eating meat. Some think it’s healthier, others are concerned about greenhouse gasses, and a few just don’t like meat.
But I love the smell of barbecue.
Contrary to what some people believe about vegetarians, I don’t dislike meat. I love it. The crispy skin on a chicken leg, the juicy inside of a steak that’s just right. Bacon. I just choose to not eat any of those things anymore, because I don’t agree with the way chickens, cows, and pigs are kept and killed just so we can enjoy their meat.
That moral decision will once in a while bring up the hypothetical question whether I would eat test tube meat. I don’t know. Would I? Ethically, yes. None of my arguments for denying myself meat apply to test tube meat. Okay, there is a source animal somewhere from which the starting cells have to be taken, but that is no different from the many cell biology experiments I did in the lab. If I can do tissue culture work – and I have done a lot of that – then I can eat test tube meat.
But test tubes and petri dishes make me think of research, not of food. I am picturing meat soaked in DMEM. Would I eat that? I don’t know.
Until very recently, it didn’t matter. It was just a hypothetical question, but now test tube meat has become a reality. Mark Post of the University of Maastricht has been optimizing the process of growing meat in the lab, and he will unveil the first lab-grown burger later this year.
Test-tube-meat.jpg
Meat in a petri dish. (Image: Mark Post, Maastricht University.)
The research leading up to it has cost about £200,000, reports the Guardian, and was funded by an anonymous individual donor. It’s a lot for a burger, as the newspaper rightly points out, but it’s a reasonable amount of money for a research project. And if you compare it to the billions that foot-and-mouth disease cost, it’s a bargain.
“If lab-grown meat mimics farmed meat perfectly – and Post admits it may not – the meat could become a premium product just as free range and organic items have.
He said that in conversations with the Dutch Society of Vegetarians, the chairman estimated half its members would start to eat meat if he could guarantee that it cost fewer animal lives.”
Half would, half wouldn’t, and I’m still on the fence. Would I eat lab-grown meat? Would you?

SciBarCamb and you

SciBarCamb will be back on April 20/21, and registration has opened (although the cheapest tickets are almost gone now) so I thought I’d explain why you might want to attend and what you can expect when you go.
If you’re in a rush, you can get the gist of it by just reading the bold text and looking at the pictures/videos.
Q. What is SciBarCamb?
A. It’s a gathering of scientists, students, publishers, technologists, educators, policy makers, and anyone else with an interest in science.
The programme is decided by the participants, making SciBarCamb an informal way to discuss a large variety of topics with people who share similar interests.
The name is an abbreviation of “SciBarCamp Cambridge”, and there have been similar events in Toronto, Palo Alto, and Vienna. To find out more about the meaning of the name, read about the etymology of SciBarCamb.
Q. Who is it for?
A. You.
Anyone who is interested in research, technology, education, publishing, policy – anything related to science – is welcome at SciBarCamb. Even a senior scientist is a lay person outside of their own specific field, and due to the broad nature of SciBarCamb, everyone is effectively equal.
Past attendees of various SciBarCamp events have included: students, artists (creative/music/performance), lab heads, publishers/editors, writers (fiction and non-fiction), postdocs, techs, techies, journalists, teachers, entrepreneurs.
The current registration list for SciBarCamb 2012 includes graduate students, postdocs, programmers, science bloggers, journal editors, data enthusiasts, an animator/illustrator, and Cambridge MP Julian Huppert.

Cambridge 2011

Toronto 2008
Q. Who decides the program?
A. You.
On the evening of April 20, we will all get together, mingle, meet each other, have some drinks, and write down suggestions for the next day’s program. It helps to think about it beforehand, especially if you’re proposing a demo that needs a bit of preparation, but even that is not required. Some of the most interesting discussions have been those that were thought up on the spot, when two people met over drinks and started talking. There are plenty of available time slots, so don’t hesitate to suggest a topic.

Last year’s programme in process
Q. Who gives the talks and hosts the discussions?
A. You.
Anyone can suggest a session. Discussions are always popular; sales pitches not so much: SciBarCamb is very interactive, so don’t expect to be able to give a 30 minute talk without interruptions, but rather show what you’re doing, and open the floor to questions.
If you can bring something to show (a machine that does something, a thing you made, something pretty, or something people can touch) that would be absolutely perfect.
My personal favourite SciBarCamb sessions from the ones I’ve attended over the years, in no particular order: Quantum Mechanics for ten year olds, Mars Rovers demonstration, making a DNA molecule out of balloons, open source drug development, the role of celebrities in science communication, various discussions about the future of science and scientific publishing, and all the geeky musical performances.
But that’s just me. I’m pretty sure if you ask someone else, they would say “discussions about data sharing” or “demonstrations of new web tools” or something else. So really, anything YOU are interested in is going to be interesting to someone else, and would make a good SciBarCamb session. The only “bad” kind of SciBarCamb session would be if you pulled up the slides from the last talk you gave for work and repeated that. That’s not what SciBarCamb is for. It’s MUCH broader.

23andMe talk, Palo Alto 2009

Mars Rover demo, Toronto 2008
Q. Who organises SciBarCamb?
A. You.
Well, maybe not this particular one, but you can organise your own SciBarCamp. Two attendees of SciBarCamb 2011 later organised SciBarCamp Vienna, so the chance that you, too, will end up organising a SciBarCamp is not entirely absurd, and in fact that’s part of the concept. To find out more about the , read this report about the first SciBarCamp and these tips for organising your own
This particular event is brought to you by: Eva Amsen, Michelle Brook, Taylor Burns, Maria Cruz, Dan Hagon, Jonathan Lawson, Matt Wood, Lou Woodley.
Our first confirmed sponsor is nature.com but I’ll update this later to reflect all sponsors.
You can also support us by buying a “Molecule” ticket for just £25. Aside from your regular registration benefits (participation, lunch), that ticket will get you eternal gratitude and a F1000 T-shirt.

Balloon DNA at the Eagle pub, Cambridge 2011

One of the breakout sessions in progress, Cambridge 2011

I wrote a program

Earlier this year I shared that I had started doing Codeyear. After a few weeks, I realized I now knew enough to write a very basic program that translates DNA to protein. It took me a few days, and it’s super clunky, but it works!
Try entering “atggaatcatcggccggggag” to find a message. :) (Hehe. Lame, I know.)
When you type in a string of A, C, G, and T it finds the first ATG to start from, and then translates codons until it hits a stop codon or the end of the sequence.
Nothing very groundbreaking (it doesn’t even understand upstream sequences!), but I’m excited that I got it to work! I learned C in undergrad, but never used it after the one course, and only ever did html/css for websites since then. So this is my first “useful” program.