Browsing Category : Expression Patterns

The Network Formerly Known As Nature Network


As of yesterday, most of the Nature Network blogs have moved to SciLogs, where Khalil Cassimally is their new community manager. I’ve known about this for a while, and having to move was the final motivation for me to get organized and put all my stuff (back) on easternblot.net. Bob didn’t move with the rest either, but I can’t find…

Read More »

Bora’s Science Blogging Post


The title above should be read in the same way as you would read “McGraw-Hill Encyclopedia of Science and Technology” or “Merriam-Webster’s Dictionary of English Usage”. Bora’s post is a resource on a very specific topic, and future generations will refer to “the Bora” when they talk about the article. The fact that Bora remembers that I was one of…

Read More »

Don’t tell me not to learn!


I mentioned at the start of the year that I was doing CodeYear. You may be wondering how that is going. Still going strong! After about 5 weeks I cobbled together a little DNA-translator; a few weeks later I finished the entire JavaScript section. We’re now in html/css lessons, but I already know most of that, so I’m not learning…

Read More »

SciBarCamb intro game


SciBarCamb is over, but it was awesome this year! I am the worst at live-tweeting, but luckily Lou and Laura and lots of other enthusiastic Twitter-users were at hand to document every single minute of it, so keep an eye on the Schemes and Memes blog for Storify collections of the whole event. I’ll just leave it to two things…

Read More »

Hoping they’ll lose Pinterest


The people who introduced me to blogging were not scientists or academics. They were online friends I’d met through playing games. A few of them set up their first blogs in 2001, and I thought it looked fun, so I started one as well. It was on an archaic blogging platform that doesn’t exist anymore. B2? Greymatter? Whichever came first.…

Read More »

Massive brain dump – unanswered questions


1.) SciBarCamb is in two weeks. If you’d like to spend a day-and-a-half meeting interesting people and talking about science in Cambridge for only £10 – sign up . Ideas for sessions go here YouTube videos of demos people are bringing along are here 2.) Nature Precedings is closing. I have a manuscript in there, and the archive will stay,…

Read More »

Not even a little bit qualified


I was as surprised as you are to find out that I am an expert on hematopoiesis and stem cells, but for the past several months I’ve been invited to several conferences asking me to speak on this topic, as well as other topics that I can’t even remember. All invitations came from BIT Life Sciences, who run a series…

Read More »

Would I eat that?


It’s something I rarely talk about, but this year is my 10th anniversary of being vegetarian. I don’t know exactly when, because it was a very gradual process. I started slowly phasing out meat from my diet in the late nineties, but lapsed in early 2001, when I was staying in Quebec for four months. Soon after I got back…

Read More »

SciBarCamb and you


SciBarCamb will be back on April 20/21, and registration has opened (although the cheapest tickets are almost gone now) so I thought I’d explain why you might want to attend and what you can expect when you go. If you’re in a rush, you can get the gist of it by just reading the bold text and looking at the…

Read More »

I wrote a program


Earlier this year I shared that I had started doing Codeyear. After a few weeks, I realized I now knew enough to write a very basic program that translates DNA to protein. It took me a few days, and it’s super clunky, but it works! Try entering “atggaatcatcggccggggag” to find a message. 🙂 (Hehe. Lame, I know.) When you type…

Read More »