Tag Archives : technology

Don’t tell me not to learn!


I mentioned at the start of the year that I was doing CodeYear. You may be wondering how that is going. Still going strong! After about 5 weeks I cobbled together a little DNA-translator; a few weeks later I finished the entire JavaScript section. We’re now in html/css lessons, but I already know most of that, so I’m not learning…
Read More »

I wrote a program


Earlier this year I shared that I had started doing Codeyear. After a few weeks, I realized I now knew enough to write a very basic program that translates DNA to protein. It took me a few days, and it’s super clunky, but it works! Try entering “atggaatcatcggccggggag” to find a message. 🙂 (Hehe. Lame, I know.) When you type…
Read More »

Can technology protect against fraud?


Even though I’ve left the lab a few years ago, I’m still interested in what goes on in labs. Perhaps even more than before, because I can now take a step back to think about things in a broader sense. Take lab notebooks, for example. There was a news article in Nature this week about going digital in the lab.…
Read More »

Scientists and musicians on Twitter


Not my project, but David Bradley has compiled a Twitter list of scientists who are also musicians (or vice versa). There are now 35 people on the Twitter list, and the first 25 are also on his blog. A few people on that list I already knew of, or had jotted down their name for my own project, so I’m…

Read More »